navigation info

Questo blog ha una struttura differente dagli altri; i post sono solo 3 (per ora): il primo si è reso nescessario per evitare una qualche confusione nella sessione "Notizie, discusse a 360°". Il secondo è specifio ed è l'arogmente principale. Il terzo post rappresenta una sessione dove chiunque può inserire un commento ad un argomento esistente, o semplicemente proporne uno nuovo. Tutti e 3 sono liberi: quindi chiunque può commentare, cliccando sul titolo del post e, nella nuova pagina che compare, andare in fondo cliccando su posta un commento.

2007-04-10

Vita: dall'atomo all'uomo

Centro nevralgico di osTol, ovvero "la vita come molecola"

10 commenti:

pfm ha detto...

Se qualcuno vi domandasse “Che cosa è la vita?”, non esitate a rispondere “Una molecola”. Si avete letto bene, una molecola; tutto quello che siamo lo dobbiamo ad una serie di eventi apparentemente fortuiti (arriverò a dire obbligati ed inevitabili) che hanno prodotto una strana sostanza che probabilmente per la prima volta in natura si dimostrò molto brava ad auto- replicarsi. E’ necessario partire da molto molto lontano e chiedersi: Come si forma una molecola? E come fanno un certo tipo a replicarsi da sole?... La natura che ci circonda è fatta di atomi, la famosa particella indivisibile (oggi sappiamo non essere più così “a- tomòs”). Gli atomi raramente si trovano come tali, il più delle volte si “attaccano” gli uni con gli altri per formare, talvolta sostanze ben definite, altre volte meno, che si chiamano molecole; bene! Perché? Rispondere a questa domanda è molto difficile, ma se vi dovessero chiedere perché gli oggetti cadono, cosa rispondereste? C’è la forza di Gravità che ci permette di non “staccarci” dalla Terra, impedendoci di arrivare chissà dove nello spazio. Si può rispondere allo stesso modo anche per gli atomi; perché si “attaccano”? Semplice, perché c’è una forza che li fa dirigere uno contro l’altro, diciamo una cugina della forza di gravità, e come quest’ultima esiste in natura e basta, senza un perché ultimo; possiamo dire solo che c’è! ...

pfm ha detto...

...Tuttavia, se si provano a cercare delle analogie tra queste forze se ne scopre una eccezionale che vale sempre in natura: sia una palla prima di cadere che due atomi prima di unirsi hanno un’energia maggiore di quella che avranno quando saranno, rispettivamente, al suolo ed uniti in una molecola! Procedendo da questa osservazione, diremo allora che gli oggetti in natura tendono ad uno stato di minore energia. E quindi? E quindi, diciamo che le molecole si formano semplicemente perché si trovano in uno stato di minore energia o se vogliamo, la maggior parte degli atomi hanno così tanta energia che sono costretti a cederla all’ambiente (sono cioè instabili); va da se quindi, che il miglior modo per stabilizzarsi è formare un aggregato di atomi, una molecola, in modo da cedere parte dell’energia all’ambiente e risultare stabili! Questa regola, vale sia per la materia vivente, che per quella non vivente. In passato si riteneva che queste due fossero completamente distinte. Oggi sappiamo che qualsiasi cosa in natura è formata dagli stessi atomi; ce ne sono circa 90, e con questo numero limitato il caso ha creato una immensità di aggregati, tutti diversi; tra questi c’è anche la materia vivente. Siamo fatti della stessa cosa di cui sono fatte le stelle, disse un tale; è proprio così!...

pfm ha detto...

...Ciò nonostante, non tutti gli atomi possono reagire con un altra particella; ci sono infatti delle leggi che governano questi legami; per chiarire un attimo, semplificando molto, una particella di nome A se ha una carica + verrà respinta da una particella di nome B anch’essa positiva e non si potrà legare con essa, mentre troverà una situazione molto stabile se si “attaccherà” con una particella C carica negativamente; in altre parole A+B avrebbe una energia molto più alta di A e di B e quindi non rispetterebbe la regola che abbiamo visto essere fondamentale. Cosa voglio dire con tutto questo? E’ semplice; le molecole hanno iniziato a formarsi con l’universo, comparendo poi in momenti diversi. Tra queste ce n’erano alcune in particolare, oggi conosciute come essenziali alla vita che risultano essere tra le più recenti. Negli anni 50, un certo Miller, dimostrò come sostanze di questo tipo si potevano formare dal nulla, o meglio da atomi e molecole molto semplici, ricreando in una bolla di vetro le stesse condizioni ambientali che la Terra dimostrava miliardi di anni fa. I risultati furono brillanti; cosa fece Miller in poche parole? Una torta, utilizzando degli ingredienti: Acqua, Azoto, Ossigeno, Idrogeno, Carbonio, Fosforo e altre sostanze; le mise a mollo e fece passare nell’acqua scariche elettriche ripetute (i fulmini erano molto frequenti). Dopo diverso tempo, erano comparsi degli aminoacidi, i così detti mattoni della vita, cioè i costituenti delle proteine; in effetti questi sono insufficienti, da soli, alla vita. In questo scenario primordiale, si vennero a trovare anche altre molecole che dimostrarono a differenza di altre una insolita capacità: grazie ai continui sbalzi di temperatura queste molecole si copiavano e ricopiavano, raggiungendo molto probabilmente concentrazioni estremamente elevate. Siamo dunque arrivati alla seconda domanda dell’introduzione: come fa una molecola a copiarsi da sola? Questa caratteristica è in effetti propria di una sola classe di molecole: gli Acidi Nucleici (ecco svelato il nome della magica “vita”)...

Giuseppe (UV) ha detto...

Tuttavia è ancora un mistero come si possano essere formati questi ultimi.

Passare da semplici amminoacidi a complesse catene lunghe anche solo una decina di micron non dev'essere stato affatto facile men che meno breve....

Può mai essere che questo passaggio sia frutto di un Dio e che la "creazione" non vada presa in senso stretto come la creazione di un adamo e di una eva, ma semplicemente l'innesco della vita all'interno della materia inanimata fornita da un essere superiore?!

pfm ha detto...

Nessuno si sogna di dire che questo processo sia stato breve... Ne' tantomeno, che le prime catene lunghe siano state di aminoacidi; anzi! Sono convinto che questi processi siano stati molto lenti e lunghi e come avrò modo di dire in seguito, basati sulla polimerizzazione spontanea di primitive catene di basi azotate che sono molto differenti dagli aminoacidi. La polimerizzazione spontanea catalizzata è nota oggi avvenire in provetta: basti pensare alla PCR.

pfm ha detto...

...L’acido nucleico è un nome generico per identificare il DNA e l’RNA, due molecole la cui importanza è fondamentale: contengono l’informazione genetica. Che cosa voglio dire, quindi, affermando che la vita è una molecola? Una cosa molto semplice; il nostro DNA, che chimicamente ha la capacità AUTONOMA di replicarsi ha dato inizio alla vita, primordiale certamente, ma che l’evoluzione (altra caratteristica intrinseca dipendente da questa molecola) ha reso UOMO. Ma procediamo per ordine. L’unita fondamentale di un acido nucleico è la base azotata (se vogliamo l’ultima parte veramente capace di contenere una informazione); questa non è altro che una molecola (tanto per cambiare) che contiene Azoto, Carbonio, Idrogeno, Ossigeno (vi ricordano qualcosa questi “ingredienti?”). Ne esistono un gran numero, ma quelle che ci interessano sono in effetti solo 4; avete mai visto quelle lunghe sequenze di lettere che talvolta si vedono o in televisione o su un giornale? Tipo questa:

TTTCGTAGGCCCATAGCCGAGAAAATATAGGCA
CTTTTAGAGATATATCGGGACGCACA

Come potete notare in questa sequenza, sebbene lunga, le lettere che si ripetono sono solo 4; ecco le nostre basi azotate. In un momento molto preciso di qualche miliardo di anni fa, in qualche parte sulla Terra (o chi sa, forse, in qualche altro punto dell’universo) si formò la prima base azotata, per una combinazione fortuita (oppure obbligata) di concentrazioni, temperatura, energia (anche elettrica ed elettrostatica, di origine meteorologica) e soprattutto perché era una molecola molto stabile e gli atomi che da soli erano instabili la “individuarono” come una delle tante possibilità per abbassare la loro energia...

pfm ha detto...

...Questo è uno dei motivi principali per cui risultano molto deboli argomentazioni del tipo: “Ma tra tutte le molecole che si potevano formare, perché proprio questo tipo che poi sarebbe servito alla formazione del DNA ha preso il sopravvento? Allora c’è una volontà divina che ha scelto.” Naturalmente non c’è una volontà divina, almeno non direttamente. La confutazione a questa argomentazione è che sebbene il numero di molecole che si possono formare da un numero di atomi è molto grande, ci sono delle leggi che governano la loro interazione (ricordate le particelle A e B e C cariche?) per le quali si rende quasi inevitabile la formazione di quel determinato composto; per intenderci: se metto in un contenitore ad alta pressione e temperatura Idrogeno ed Ossigeno è inevitabile che si formi acqua. Quindi la formazione delle basi azotate si ripeté miliardi di volte in maniera, oserei dire proprio inevitabile, probabilmente perché queste condizioni ideali si mantennero per lunghi periodi di tempo e la quantità di queste molecole aumentò progressivamente. Queste elevate concentrazioni favorirono il raggiungimento di un altro ordine di stabilità, formato da tante basi attaccate insieme in catena. Ho detto prima che gli atomi si formano perché sostanzialmente sono instabili; i gradi di stabilità e d’instabilità sono concetti relativi nel senso che se abbiamo A e B che questa volta si stabilizzano formando A+B, andranno oltre nel formare, con una terza particella C, A+B+C se questa conformazione risulterà ancora più stabile di A+B. Questa caratteristica, come in tutte le reazioni chimiche, è fortemente favorita dalla concentrazione; cioè se ci sono tantissimi aggregati A+B e tantissime particelle C, la formazione del triplice blocco A+B+C sarà ancora più probabile da attuarsi...

Anonimo ha detto...

Abbiamo molte idee in comune. Voglio seguire sistematicamente le tue pubblicazioni. Ma tu perché non guardi anche le mie e mi lasci un commento?
gioacchino
http://boffa.blog.tiscali.it

pfm ha detto...

...Questo può sembrare abbastanza intuitivo, ma c’è una teoria che spiega questo fenomeno: la formazione di una molecola avviene sì, come ho già detto, per motivi energetici e per leggi intrinseche della materia, ma queste si possono mettere in atto solo quando 2 o più atomi (o 2 o più molecole) urtano gli uni contro gli altri; è questa la teoria degli urti efficaci. Premesso dunque che una molecola si forma dopo un urto tra due particelle instabili, diventa ora davvero intuitivo che se il numero di particelle che devono urtare è molto elevato, questi stessi urti saranno molto frequenti e di conseguenza lo saranno quelli efficaci e quindi si formeranno più prodotti (in questo caso il nostro aggregato triplice A+B+C). Un altro modo per far aumentare la frequenza degli urti è quello di far muovere le particelle più velocemente; si può fare questo fornendo calore ed in generale quindi energia (ecco le scariche elettriche di Miller); difatti la temperatura è un indice di quanto le particelle si muovono rapidamente, per cui se diamo calore ad una miscela di sostanze queste aumentano la loro temperature nel senso che si muovono più velocemente, e questo favorisce la loro interazione per formare un qualche prodotto. Con questo esempio tutto sarà più semplice (spero non troppo):
Prendete 2 magneti e metteteli in una scatola abbastanza grande; muovete la scatola lentamente per un po’, e dopo apritela. Ripetete questo 100 volte. Contate le volte che ad ogni apertura avete trovato i magneti attaccati.
Ora prendete 20 magneti e metteteli nella stessa scatola; muovete la scatola vigorosamente e dopo apritela. Ripetetelo 100 volte. Contate le volte che ad ogni apertura avete trovato i magneti attaccati.
Questo banale esempio dovrebbe chiarire molto le idee: secondo voi in quale caso conterete più magneti attaccati? Ovviamente nel secondo...

pfm ha detto...

Sulla Terra primordiale queste “scatole” con miliardi di “magneti” dovevano essere abbastanza comuni; la temperatura elevata e le scariche elettriche facevano la loro parte. Si formò così una lunga catena di basi azotate, proprio come quella scritta prima sopra. Ma perché iniziarono a replicarsi? Probabilmente prima che questo avvenisse passarono milioni di anni, perché si rendeva necessario un abbassamento delle temperature e della frequenza delle scariche (infatti questi stessi fattori, temperatura e scariche elettriche, oltre a favorire la formazione di composti possono anche distruggerli; in poche parole più una sostanza è stabile, più energia servirà a scomporlo nelle sue particelle fondamentali). Per capire però come una catena di basi azotate possa auto- replicarsi è necessario avere una minima conoscenza di come questa si presenta e a questo punto possiamo anche dare il nome a ciascuna base:

T = timina, A = adenina,
C = citosina, G = guanina

Sebbene tutte diverse, sono molto simili tra di loro e soprattutto l’adenina è più simile alla guanina e la timina è più simile alla citosina, se non altro per un motivo di dimensioni, che vedremo poi essere molto importante per la stabilità del vero e proprio DNA (attenzione, ancora utilizzo il termine catena di basi azotate perché DNA ed RNA sono 2 cose un po’ più complesse). Un’altra caratteristica simile è che queste molecole vanno immaginate (sebbene la loro forma reale sia molto diversa da questa) come un triangolo che presenta a ciascuno dei 3 vertici un braccio. Tanti triangoli si mettono in catena attaccandosi con i bracci della base, formando così un alternanza triangolo - braccio+braccio - triangolo.

Ad ogni vertice superiore c’è poi un terzo braccio che in qualche modo dobbiamo immaginare come una sporgenza da questa catena; questo altro braccio ha la capacità di legarsi con uno opposto di un’altra base che gli si presenta di fronte “a testa in giù”.